Fastest way to tell steam issues are not restricted to just you/your computer/your connection. (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/7e/27/7e2777875086f41822b1a6c80f6c226361f5e00858d42562cf8c69d5d0664d9e.png)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
LADDERS IN EASTERN EUROPE...
I’m not sure if it’s a coincidence, but I raised a case with the ICO in the UK, and today they got back to me asking for all my communication with Reddit. Also today - after a month of silence - Reddit also emailed me with this...
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
Solution: Use NFS -_-’...