Oompah loompah doopity doo (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/fd/d9/fdd9c6376be3e676bb1659275cf45ba3e9a8113e8125a21c33837630f602946d.jpg)
The only political map I need (i.imgur.com)
How I feel about capitalist bootlicking from ex-Reddit community (lemmy.ml)
and some reading material for capitalism stans on here...
![](https://kbin.life/media/cache/resolve/entry_thumb/cd/38/cd38ed89db2aae4f4a140bf610f5783310b694bf2b6209b42529179ced09d745.jpg)
Bot issues (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/8a/99/8a99d39ecb0073726f8ffc7f9f695c662f7a605052919a4108d8b8e19acef6e1.jpg)
One last Chuck (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/cc/07/cc079004e3f9682691fb51767caa076c26af2cf5054e99ece30ce9ee383e2513.jpg)
How i feel on Lemmy (programming.dev)
![](https://kbin.life/media/cache/resolve/entry_thumb/3f/0f/3f0f3cf0fc02c77d0e4f2d2da352a6013e4aaff549983d3c1baab9059324f135.jpg)
Plant based rice (lemmy.world)
Miracle Rice…...
![](https://kbin.life/media/cache/resolve/entry_thumb/6b/1f/6b1fb17aa1e0214be7184b145c0e5c1b6661b1c347f940055ba922505bf1689b.png)
My mother was a virgin (lemmy.tf)
![](https://kbin.life/media/cache/resolve/entry_thumb/10/f8/10f8b0b3051b71253a6ed90e9b72fda6ecbdea89a7a3d14db9829c0fea5b4fc6.jpg)
10 year old memes (sh.itjust.works)
![](https://kbin.life/media/cache/resolve/entry_thumb/b9/17/b91755487ec63423a5d14f1387cd1176be6c10bf4b0a0e528aeff0397dde90ef.webp)
One hand at 2 is the way (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/62/ff/62ff54847cc1f13ec012b1388b16a49272adf48048679a2b71d718c00d7a12ab.png)
I do remember (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/c0/4d/c04d8c0fd040ff6a3556ed2497817acad3e0f849b706980b11d7ebddd4e5c6d4.png)
i’ve multiclassed too many times (i.imgur.com)
Vin Diesel can probably tell even while he’s asleep (i.imgur.com)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
![](https://kbin.life/media/cache/resolve/entry_thumb/d9/7f/d97fc69419f5ff27d721204782a7937eeb606f30eac9b52b3eebdd5a272a2429.jpg)
Run! Run! Run! (i.imgur.com)
Package Managers (lemm.ee)
![](https://kbin.life/media/cache/resolve/entry_thumb/9e/5b/9e5b74c0d3ff32f9d95bb0777e0b007285f3a59fe0c02b87e2753500cdb5f1ad.webp)
Goth Fan Here (i.imgur.com)
killer (slrpnk.net)
cross-posted from: slrpnk.net/post/884646...
![](https://kbin.life/media/cache/resolve/entry_thumb/d7/55/d755e90094da367e3d9a660d56e76af99422c61101f0a01e5ac600c2e0c4dd6a.webp)
I'd have rather had the wooden spoon (slrpnk.net)
![](https://kbin.life/media/cache/resolve/entry_thumb/e4/29/e42967c676a33cab37da49d22d6ed941cc32cf46918fe13e93e2d23c75c319f5.webp)
GAFAM removed successfully (feddit.de)
![](https://kbin.life/media/cache/resolve/entry_thumb/f8/91/f891ddb77e95455f1df49cf0cab64c358c58c8a2f047c3b8c6c7063a8ed7f186.jpg)
it's been a rough decade or so (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/ec/b0/ecb0d9c763f0533d68c5b8206aa5a03c10c74fed83cbcb79a097060d0c5173b9.png)
With seemingly at least one new app announced per day.... (thelemmy.club)
![](https://kbin.life/media/cache/resolve/entry_thumb/09/9f/099f19038aab342786945322d96f9f125b3fc9d7cdd80d23a476b2cc47ac2cb5.jpg)
So wise (pawb.social)
Im starting to run out of memes
![](https://kbin.life/media/cache/resolve/entry_thumb/73/1a/731a89c9141c9e6726494f7fe3d45a76f6329fe8f0fde08d8d4ae6eff010c8b1.jpg)