at least my 3 money (delivery) maki kappa only costed 2,5 money (at shop) the 60 metres away, dont remember the profit margin of the other products (feddit.de)
we need more memes, there's too much news in my feed (lemmy.world)
Oh no... (lemmy.world)
Can anyone help me understand the plot? (lemmy.ml)
The Counteroffensive (lemmygrad.ml)
It's the rain (lemmy.world)
G.I. Joe has a message: (feddit.de)
G.I. Joe has a message:...
i was crazy once (pawb.social)
Chris Nolan this month. (lemmy.world)
I hope memes in spnish are ok 🥺 (lemmy.world)
Give me the plant (lemmy.world)
Oompah loompah doopity doo (lemmy.world)
A misty morning along the Green River, Wyoming, USA. [2002x3000] (i.redd.it)
Original Source: https://www.reddit.com/r/EarthPorn/comments/12m15k9/a_misty_morning_along_the_green_river_wyoming_usa/
Plant based rice (lemmy.world)
Miracle Rice…...
Vin Diesel can probably tell even while he’s asleep (i.imgur.com)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
Surf and Turf - Pacific North West (lemmy.world)
Red Rock crab and New York steak.