Sad internet addiction noises (lemmy.dbzer0.com)
Before you tell me to touch grass, grass is kinda illegal here in the US (if you know what I mean by “grass” 😉).
![](https://kbin.life/media/cache/resolve/entry_thumb/e6/28/e6285cce6e43e3ab034c042fc7e2eac61d48bf7eee94c7343abc38675f57aece.jpg)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
This magazine is from a federated server and may be incomplete. Browse more on the original instance.
Before you tell me to touch grass, grass is kinda illegal here in the US (if you know what I mean by “grass” 😉).
cross-posted from: slrpnk.net/post/884646...
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
I know you can play the game at chrome://dino, but it doesn’t evoke the same nostalgic feeling of a 10yr old me turning on aeroplane mode and spamming space bar to try and beat my brother’s high score. Good memories.
https://beehaw.org/pictrs/image/1dcab335-0316-47ea-94d4-9a7c23a41e80.webp
https://imgur.io/gallery/yJJMCke!
imgur.io/gallery/yJJMCke