My mother was a virgin (lemmy.tf)
![](https://kbin.life/media/cache/resolve/entry_thumb/10/f8/10f8b0b3051b71253a6ed90e9b72fda6ecbdea89a7a3d14db9829c0fea5b4fc6.jpg)
Goth Fan Here (i.imgur.com)
killer (slrpnk.net)
cross-posted from: slrpnk.net/post/884646...
![](https://kbin.life/media/cache/resolve/entry_thumb/d7/55/d755e90094da367e3d9a660d56e76af99422c61101f0a01e5ac600c2e0c4dd6a.webp)
Vin Diesel can probably tell even while he’s asleep (i.imgur.com)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
![](https://kbin.life/media/cache/resolve/entry_thumb/d9/7f/d97fc69419f5ff27d721204782a7937eeb606f30eac9b52b3eebdd5a272a2429.jpg)
Package Managers (lemm.ee)
![](https://kbin.life/media/cache/resolve/entry_thumb/9e/5b/9e5b74c0d3ff32f9d95bb0777e0b007285f3a59fe0c02b87e2753500cdb5f1ad.webp)
3 browsers (lemmy.world)
I know you can play the game at chrome://dino, but it doesn’t evoke the same nostalgic feeling of a 10yr old me turning on aeroplane mode and spamming space bar to try and beat my brother’s high score. Good memories.
![](https://kbin.life/media/cache/resolve/entry_thumb/43/b0/43b0df80c39e35e7c3699c4d404d27b92553188f84f0d21ddc3dc6e24e6fef97.png)
One last Chuck (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/cc/07/cc079004e3f9682691fb51767caa076c26af2cf5054e99ece30ce9ee383e2513.jpg)
i’ve multiclassed too many times (i.imgur.com)
I’ll take it (i.imgur.com)
I dug this one from the grave
https://beehaw.org/pictrs/image/1dcab335-0316-47ea-94d4-9a7c23a41e80.webp
I do remember (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/c0/4d/c04d8c0fd040ff6a3556ed2497817acad3e0f849b706980b11d7ebddd4e5c6d4.png)
it's been a rough decade or so (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/ec/b0/ecb0d9c763f0533d68c5b8206aa5a03c10c74fed83cbcb79a097060d0c5173b9.png)
problems are stacking up (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/2b/47/2b478282dbbd7eb041c2af5b2ac58303182c2a52f4c102f568cfaa91960e829d.jpg)
political words (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/57/85/57858146ef487d8483ddba08fa792150e55a918a6881e44cfe28c5dd4472734c.jpg)
10 year old memes (sh.itjust.works)
![](https://kbin.life/media/cache/resolve/entry_thumb/b9/17/b91755487ec63423a5d14f1387cd1176be6c10bf4b0a0e528aeff0397dde90ef.webp)
Spiderman on STFUF
https://imgur.io/gallery/yJJMCke!
Spiderman on STFUF
imgur.io/gallery/yJJMCke
Spiderman on STFUF
imgur.io/gallery/yJJMCke
Annie are you ok
annie are you ok
I'd have rather had the wooden spoon (slrpnk.net)
![](https://kbin.life/media/cache/resolve/entry_thumb/e4/29/e42967c676a33cab37da49d22d6ed941cc32cf46918fe13e93e2d23c75c319f5.webp)
So wise (pawb.social)
Im starting to run out of memes
![](https://kbin.life/media/cache/resolve/entry_thumb/73/1a/731a89c9141c9e6726494f7fe3d45a76f6329fe8f0fde08d8d4ae6eff010c8b1.jpg)
No IPA (imgur.com)
imgur.com/blqSj5T