AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
![](https://kbin.life/media/cache/resolve/entry_thumb/d9/7f/d97fc69419f5ff27d721204782a7937eeb606f30eac9b52b3eebdd5a272a2429.jpg)
Package Managers (lemm.ee)
![](https://kbin.life/media/cache/resolve/entry_thumb/9e/5b/9e5b74c0d3ff32f9d95bb0777e0b007285f3a59fe0c02b87e2753500cdb5f1ad.webp)
i’ve multiclassed too many times (i.imgur.com)
I’ll take it (i.imgur.com)
I dug this one from the grave
https://beehaw.org/pictrs/image/1dcab335-0316-47ea-94d4-9a7c23a41e80.webp
I do remember (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/c0/4d/c04d8c0fd040ff6a3556ed2497817acad3e0f849b706980b11d7ebddd4e5c6d4.png)
it's been a rough decade or so (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/ec/b0/ecb0d9c763f0533d68c5b8206aa5a03c10c74fed83cbcb79a097060d0c5173b9.png)
problems are stacking up (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/2b/47/2b478282dbbd7eb041c2af5b2ac58303182c2a52f4c102f568cfaa91960e829d.jpg)
political words (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/57/85/57858146ef487d8483ddba08fa792150e55a918a6881e44cfe28c5dd4472734c.jpg)
Spiderman on STFUF
https://imgur.io/gallery/yJJMCke!
Spiderman on STFUF
imgur.io/gallery/yJJMCke
Spiderman on STFUF
imgur.io/gallery/yJJMCke
Annie are you ok
annie are you ok
I'd have rather had the wooden spoon (slrpnk.net)
![](https://kbin.life/media/cache/resolve/entry_thumb/e4/29/e42967c676a33cab37da49d22d6ed941cc32cf46918fe13e93e2d23c75c319f5.webp)
So wise (pawb.social)
Im starting to run out of memes
![](https://kbin.life/media/cache/resolve/entry_thumb/73/1a/731a89c9141c9e6726494f7fe3d45a76f6329fe8f0fde08d8d4ae6eff010c8b1.jpg)
No IPA (imgur.com)
imgur.com/blqSj5T
Need some peaches n onions
Fine. I’ll join in. (i.imgur.com)
Cat rule (lemmy.sdf.org)
On top of the image is title reading “Humans when cat:”. The image is a screenshot from game showing truck with text “psps” next to a logo on blue background. The logo and text font are similar to those of Pepsi (brand of carbonated soft drink).
![](https://kbin.life/media/cache/resolve/entry_thumb/6c/3f/6c3f9adc328d49e6e2c57ad271c77e0b477381a277b8814c4def706c90e38b6f.png)
With seemingly at least one new app announced per day.... (thelemmy.club)
![](https://kbin.life/media/cache/resolve/entry_thumb/09/9f/099f19038aab342786945322d96f9f125b3fc9d7cdd80d23a476b2cc47ac2cb5.jpg)
Of course I know him, he's me (lemmy.world)
![](https://kbin.life/media/cache/resolve/entry_thumb/74/a8/74a87377ea41731ff9bf919a87e57023a3c9a727af359eafcaf631fb991601ec.jpg)
It was all happening so fast (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/ce/cd/cecd7db1d8e9cb37b23ea096adaa25281960cec8718c43c35b94ae473dcec401.jpg)
I need more wasabi (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/a9/45/a945cafbf6c4ffd34ab17ec190654131632947a0818b841a6a106a80e072007c.jpg)
The Truth at Last
https://lemmy.world/pictrs/image/c143e1f5-f227-4a44-8d44-395e623c036b.webp