AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
i’ve multiclassed too many times (i.imgur.com)
I’ll take it (i.imgur.com)
I do remember (lemmy.ml)
it's been a rough decade or so (lemmy.ml)
problems are stacking up (lemmy.world)
political words (lemmy.world)
So wise (pawb.social)
Im starting to run out of memes
Fine. I’ll join in. (i.imgur.com)
Cat rule (lemmy.sdf.org)
On top of the image is title reading “Humans when cat:”. The image is a screenshot from game showing truck with text “psps” next to a logo on blue background. The logo and text font are similar to those of Pepsi (brand of carbonated soft drink).