AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
![](https://kbin.life/media/cache/resolve/entry_thumb/d9/7f/d97fc69419f5ff27d721204782a7937eeb606f30eac9b52b3eebdd5a272a2429.jpg)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
This magazine is from a federated server and may be incomplete. Browse more on the original instance.
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
I know you can play the game at chrome://dino, but it doesn’t evoke the same nostalgic feeling of a 10yr old me turning on aeroplane mode and spamming space bar to try and beat my brother’s high score. Good memories.
https://beehaw.org/pictrs/image/1dcab335-0316-47ea-94d4-9a7c23a41e80.webp
https://imgur.io/gallery/yJJMCke!
imgur.io/gallery/yJJMCke
imgur.io/gallery/yJJMCke
annie are you ok
Im starting to run out of memes
imgur.com/blqSj5T
On top of the image is title reading “Humans when cat:”. The image is a screenshot from game showing truck with text “psps” next to a logo on blue background. The logo and text font are similar to those of Pepsi (brand of carbonated soft drink).