Can anyone help me understand the plot? (lemmy.ml)
What's wrong with me?!?! (lemmy.ml)
Fastest way to tell steam issues are not restricted to just you/your computer/your connection. (lemmy.ml)
dictionary.com represent (lemmy.ml)
He's got the spirit (lemmy.ml)
Best advice (lemmy.ml)
How I feel about capitalist bootlicking from ex-Reddit community (lemmy.ml)
and some reading material for capitalism stans on here...
One last Chuck (lemmy.ml)
I do remember (lemmy.ml)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
The cat trap worked! It caught a not-so-wild Siegfrieda! (lemmy.ml)
ah, so the real gift spargle gave you was confidence! (lemmy.ml)
hello lemmy! (lemmy.ml)
it's been a rough decade or so (lemmy.ml)
It was all happening so fast (lemmy.ml)
ladders (lemmy.ml)
LADDERS IN EASTERN EUROPE...
I need more wasabi (lemmy.ml)
Introvert tip #42 (lemmy.ml)
[SOLVED] Permission problem with Radarr and smb (lemmy.ml)
Solution: Use NFS -_-’...
im pro hax0r (lemmy.ml)
Reddit claiming they weren’t recovering deleted posts (lemmy.ml)
I’m not sure if it’s a coincidence, but I raised a case with the ICO in the UK, and today they got back to me asking for all my communication with Reddit. Also today - after a month of silence - Reddit also emailed me with this...