Plant based rice (lemmy.world)
Miracle Rice…...
Vin Diesel can probably tell even while he’s asleep (i.imgur.com)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
Package Managers (lemm.ee)
The only political map I need (i.imgur.com)
I’ll take it (i.imgur.com)
quick reminder (lemmy.world)
Annie are you ok
annie are you ok
No IPA (imgur.com)
imgur.com/blqSj5T
Wait, really? (sh.itjust.works)
classique ✨ (lemmy.world)
Well I had to beat something off with a stick.... (i.imgur.com)
there's murder in those eyes (sh.itjust.works)
Hahahawho’s even allowed to go twice in a rowhahahaha! (i.imgur.com)
Hail Hydra (programming.dev)
“Cut off one limb and two more shall take its place”
Like…like this? Am I doing the thing? (lemmy.world)
Title (i.imgur.com)
Original Title (lemmy.world)
Original Text
Rockstar games milked it too much (i.postimg.cc)
Fine. I'll do it myself. (lemmy.world)
tchakk barrrr (discuss.tchncs.de)
good meme (reddthat.com)
Oh snap! (lemmy.world)
“Keep your hands off my kayak. Filthy liberals.”