Plant based rice (lemmy.world)
Miracle Rice…...
![](https://kbin.life/media/cache/resolve/entry_thumb/6b/1f/6b1fb17aa1e0214be7184b145c0e5c1b6661b1c347f940055ba922505bf1689b.png)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
This magazine is from a federated server and may be incomplete. Browse more on the original instance.
Miracle Rice…...
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
“Cut off one limb and two more shall take its place”
Original Text
“Keep your hands off my kayak. Filthy liberals.”
A few of us are doing our best to put the red dragon in the middle of a bunch of “fuck spez” messages, but we need help. The upper horn is located at 60, -173. I know we all hate reddit and don’t want to give them clicks, but I think it’ll be okay for a day if its for the sake of meme-ing on spez in honor of Dalimey100...
I’m embarrassed it took so long for one of us to make this joke. This perfect meme was just sitting there this whole freaking time.