He's got the spirit (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/ba/78/ba785c7e620220e4a9dc023bf6c22837da1efded9b728efab1b3518cc5b44c52.jpg)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
This magazine is from a federated server and may be incomplete. Browse more on the original instance.
Before you tell me to touch grass, grass is kinda illegal here in the US (if you know what I mean by “grass” 😉).
Miracle Rice…...
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”