He's got the spirit (lemmy.ml)
…it! (i.imgur.com)
I hope memes in spnish are ok 🥺 (lemmy.world)
Give me the plant (lemmy.world)
Siri Open Lemmy (lemmy.world)
Bot issues (lemmy.world)
Sad internet addiction noises (lemmy.dbzer0.com)
Before you tell me to touch grass, grass is kinda illegal here in the US (if you know what I mean by “grass” 😉).
yes (lemmy.world)
Oompah loompah doopity doo (lemmy.world)
Best advice (lemmy.ml)
GAFAM removed successfully (feddit.de)
One hand at 2 is the way (lemmy.world)
Always blows me away everytime I rewatch it (i.imgur.com)
My mother was a virgin (lemmy.tf)
Goth Fan Here (i.imgur.com)
Vin Diesel can probably tell even while he’s asleep (i.imgur.com)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
3 browsers (lemmy.world)
I know you can play the game at chrome://dino, but it doesn’t evoke the same nostalgic feeling of a 10yr old me turning on aeroplane mode and spamming space bar to try and beat my brother’s high score. Good memories.