me_irl (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/b8/7e/b87e0427587a5b093919241d201e3d373ca9d97915b1114beaaa469d46b8453e.png)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
tweet
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
I thought we were building a rice cooker.