I'm Bad to the Bone (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/5e/e7/5ee7168fc666c87256d2d592bf0c7f2fdc7efc6608c75e55ef68c6135d0c7a60.jpg)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
I was watching a video on landscape mode on my phone on YouTube. And then when a wild midroll ad appears, the ad thinks it’s a good idea to play a ultrawide-screen video inside a TikTok style vertical phone window, and then puts that in a widescreen video. The whole thing also got smaller to display the CTA at the right....
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
and some reading material for capitalism stans on here...
LADDERS IN EASTERN EUROPE...