𝕏posting (lemmy.ml)
![](https://kbin.life/media/cache/resolve/entry_thumb/ba/38/ba38fe89c4fc410851828ea88a1348a3df1f8399500ecf7a390809a5b4c013a6.png)
There have been multiple accounts created with the sole purpose of posting advertisement posts or replies containing unsolicited advertising.
Accounts which solely post advertisements, or persistently post them may be terminated.
This post is part 3 of the barbenhimer double feature review....
G.I. Joe has a message:...
Original Source: https://www.reddit.com/r/EarthPorn/comments/12m15k9/a_misty_morning_along_the_green_river_wyoming_usa/
Miracle Rice…...
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
Red Rock crab and New York steak.