He's got the spirit (lemmy.ml)
Best advice (lemmy.ml)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
I do remember (lemmy.ml)
it's been a rough decade or so (lemmy.ml)
It was all happening so fast (lemmy.ml)
I need more wasabi (lemmy.ml)
im pro hax0r (lemmy.ml)
ah, so the real gift spargle gave you was confidence! (lemmy.ml)
High quality OC (lemmy.ml)
My cats whenever I start the vacuum (lemmy.ml)
Steal this meme (lemmy.ml)
I actually find this talking point so braindead that, to this day, I still have a hard time believing that people genuinely believe it. (lemmy.ml)
Europe Classification (lemmy.ml)
at coords 91, 85 im building ILY SWARTS (lemmy.ml)
Time to hydrate (lemmy.ml)
Random text
What is my purpose (lemmy.ml)
Better (lemmy.ml)
Thanks, Pretzel Witch! (lemmy.ml)
All I want is the S L O P (lemmy.ml)
[Qtile] spacegreyed (lemmy.ml)
after experimenting with dracula, nord, catpuccin, gruvbox, solarized, and many others, i’ve settled on spacegrey....